View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_196 (Length: 236)
Name: NF20633_high_196
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_196 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 48516468 - 48516250
Alignment:
| Q |
1 |
tcacactatccttaactcatggccgaactctgaattatcagtggctctttctcagagagccagccggacggataacacacnnnnnnnnnnnnnnnnnntg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48516468 |
tcacactatccttaactcatggccgaactctgaattatcagtggctctttctcagagagccagccggacggataacacacaaaaagaaaaaaaaaa--tg |
48516371 |
T |
 |
| Q |
101 |
ttggctccacgatgtttccaatcttgcatgagatatatgggagtgaaacttggtttaacgaccaacactttgtttcctgataaagttatctcacatttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
48516370 |
ttggctccacgatgtttccaatcttgcatgagatatatgggagtgaaacttggtttaacgaccaacactttgtttcccgatcaagttatctcacatttga |
48516271 |
T |
 |
| Q |
201 |
atttcacaaagatttgcatac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48516270 |
atttcacaaagatttgcatac |
48516250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University