View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_198 (Length: 235)
Name: NF20633_high_198
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_198 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 3582046 - 3582261
Alignment:
| Q |
18 |
cttctgtagtaatttcttatccagaaacagaaattaaaaagaaagggatatacacnnnnnnnnncttcttctagatacgtagggccacacacaaatcgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
3582046 |
cttctgtagtaatttcttatccagaaacagaaattaaaaagaaaaggatatatactttttttt-cttcttctagatatgtagg-ccacacacaaatcgta |
3582143 |
T |
 |
| Q |
118 |
gtagatactcataagttaaccagaaatggtggttaagccaagtcttctccaaaatgttgacttgacaaataatgtttctccaccaaaaggctagtgaggc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
3582144 |
gtagatactcataagttaaccagaaatggtggttaagccaagttttctccaaaatgttgacttcagaaataatgtttctccaccaaaaggctagtgaggc |
3582243 |
T |
 |
| Q |
218 |
ggttttgattttgttatt |
235 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
3582244 |
ggttttgattctgttatt |
3582261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University