View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_217 (Length: 210)
Name: NF20633_high_217
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_217 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 27801405 - 27801582
Alignment:
| Q |
14 |
attattcttggctttagtggccttttggcactatgtagttgggttttcaaatctgtccggttttaccattttttccaatagaaaataattttacaccaac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27801405 |
attattcttggctttagtggccttttggcactatgtagttgggttttcaaatctgtccgattttaccattttttccaatagaaaataattttacaccaac |
27801504 |
T |
 |
| Q |
114 |
gttgcattacacgcttttacactccatagtttttaatcacttttctattttgtgcagtgagatgatgagtccattgac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27801505 |
gttgcattacacgcttttacactccatagtttttaatcacttttctattttgtgcagtgagatgatgagtccattgac |
27801582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University