View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_222 (Length: 204)
Name: NF20633_high_222
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_222 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 36785081 - 36785284
Alignment:
| Q |
1 |
ctctggaaccatcgatttcatctttgggcattcaactaccttaatccaaaactccaaaataattgcgaggaagccgagtccaggccatagcaacgttgtg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36785081 |
ctctggaaccattgatttcatctttgggcattcaactaccttaatccaaaactccaaaataattgtgaggaagccgagtccaggccatagcaacgttgtg |
36785180 |
T |
|
| Q |
101 |
gtggcagacggaacaaagcaaaagaatgccctaactggaatagtccttcaaaattgctcgatcatgccagatgttgaacttttacctgataggttgacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36785181 |
gtggcagacggaacaaagcaaaagaatgccctaactggaatagtccttcaaaattgctcgatcatgccagatgttgaacttttacctgataggttgacgg |
36785280 |
T |
|
| Q |
201 |
tgaa |
204 |
Q |
| |
|
|||| |
|
|
| T |
36785281 |
tgaa |
36785284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University