View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_43 (Length: 477)
Name: NF20633_high_43
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 448; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 448; E-Value: 0
Query Start/End: Original strand, 1 - 460
Target Start/End: Original strand, 45775364 - 45775823
Alignment:
| Q |
1 |
aaaattaaggtaatattggaagttattttaaaggggtgtttgtagtaaatatggatttatatgcaaatatgtgatgcatgctttcaaaatctttgagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45775364 |
aaaattaaggtaatattggaagttattttaaaggggtgtttgtagtaaatatggatttatatgcaaatatgtgatgcatgctttcaaaatctttgagatt |
45775463 |
T |
|
| Q |
101 |
ggaaaaaagatatgatatttgatggttctctttggtagcacctcttctccaccgttttaatgggtgtcactatcatgaaccaccaactataggctaaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45775464 |
ggaaaaaagatatgatatttgatggttctctttggtagcacctcttctccaccgttttaatgggtgtcactatcatgaaccaccaactataggctaaggg |
45775563 |
T |
|
| Q |
201 |
ccagtcggttggagtgaaggcacaagttccccatttgggcccacattgaccccactttcccatcccaaattctttgctgattttcttagtcttcgtaccg |
300 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45775564 |
ccagtcggttggagtgaaggcacaagctccccatttgggcccacagtgaccccactttcccatcccaaattctttgctgattttcttagtcttcgtaccg |
45775663 |
T |
|
| Q |
301 |
tacgcaccacgcagtctgcacccgcatagtgtctatgactgtactcactctgtacctactctcttattctctctcaaatatccaatagtagtaacagtac |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45775664 |
tacgcaccacgcagtctgcacccgcatagtgtctatgactgtactcactctgtaccaactctcttattctctctcaaatatccaatagtagtaacagtac |
45775763 |
T |
|
| Q |
401 |
cactaccagtatagtatgaatgtatgattacagacgggaaaaaccacagagattggggat |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45775764 |
cactaccagtatagtatgaatgtatgattacagacgggaaaaaccacagagattggggat |
45775823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University