View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_69 (Length: 394)
Name: NF20633_high_69
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_69 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 13 - 180
Target Start/End: Complemental strand, 30927922 - 30927760
Alignment:
| Q |
13 |
aaaataaactgatttaaatgattgactagaaagtaagtaaaggcgggagtcgacccaaatcccaaaatcaaaattaaaacatcgggccccacatcacttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30927922 |
aaaataaactgatttaaatgattgacta-----aaagtaaaggcgggagtcgacccaaatcccaaaatcaaaattaaaacatcgggccccacatcacttc |
30927828 |
T |
|
| Q |
113 |
cttctctcctctgtcacttaaaactttctgtttggctctctctttctctcttaaccttttcccatttg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30927827 |
cttctctcctctgtcacttaaaactttctgtttggctctctctttctctcttaaccttttcccatttg |
30927760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University