View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20633_high_79 (Length: 368)

Name: NF20633_high_79
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20633_high_79
NF20633_high_79
[»] chr4 (9 HSPs)
chr4 (20-269)||(9569748-9569996)
chr4 (83-178)||(9605997-9606092)
chr4 (106-207)||(9593306-9593407)
chr4 (131-210)||(9581509-9581588)
chr4 (131-210)||(9587204-9587283)
chr4 (20-101)||(9581590-9581670)
chr4 (20-101)||(9587285-9587365)
chr4 (20-61)||(9602207-9602248)
chr4 (20-61)||(9606092-9606133)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-100; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 9569748 - 9569996
Alignment:
20 gtatcgtcgctgatgcttatgtggttctgtttttggctcatccgggtctatttttctggtctgctgttgctgtttttctggtacgtggttactgtttggc 119  Q
    ||||||||||||||||||||||||||||||||| |||| |||| ||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||    
9569748 gtatcgtcgctgatgcttatgtggttctgtttt-ggctaatccaggtctgtttttctggtctgctgttgctgtctttctggtatgtggttactgtttggc 9569846  T
120 agtgggggttttggaagtttcttgggtcgatcccaccatttttctgtgcagcctccaggcttgttttttgcggcttccttgcggcctagcaaagttcact 219  Q
    |||||||||| |||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||| ||     
9569847 agtgggggttctggaagtttcttcggtcgatcccaccgtttttctgggcagcctccaggcttgttttttgcggcttccttgtggcctggcaaagtttacc 9569946  T
220 gctgttgtgttttcttctgtttgattggtggatacagttagagtatttgc 269  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||    
9569947 gctgtcgtgttttcttctgtttgattggtggatacagttagagtatttgc 9569996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 83 - 178
Target Start/End: Complemental strand, 9606092 - 9605997
Alignment:
83 ctgttgctgtttttctggtacgtggttactgtttggcagtgggggttttggaagtttcttgggtcgatcccaccatttttctgtgcagcctccagg 178  Q
    ||||||||| |||||||||  |||||| ||||||||| ||||||||| ||||||||||||||||| |||||||  |||||||||||||||| ||||    
9606092 ctgttgctgcttttctggtctgtggttgctgtttggcggtgggggttctggaagtttcttgggtcaatcccactgtttttctgtgcagccttcagg 9605997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 106 - 207
Target Start/End: Complemental strand, 9593407 - 9593306
Alignment:
106 ggttactgtttggcagtgggggttttggaagtttcttgggtcgatcccaccatttttctgtgcagcctccaggcttgttttttgcggcttccttgcggcc 205  Q
    |||| ||||||||||||||||||| ||||||| ||||| ||| |||||||| ||||| |||||||| | |||||||||||| ||||||||||| | ||||    
9593407 ggttgctgtttggcagtgggggttctggaagtgtcttgagtctatcccaccgtttttatgtgcagctttcaggcttgttttgtgcggcttcctcgtggcc 9593308  T
206 ta 207  Q
    ||    
9593307 ta 9593306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 131 - 210
Target Start/End: Complemental strand, 9581588 - 9581509
Alignment:
131 tggaagtttcttgggtcgatcccaccatttttctgtgcagcctccaggcttgttttttgcggcttccttgcggcctagca 210  Q
    |||||||||| ||||||||||||||| |||||||||||||| | |||||||||| | || ||||||||||||||||||||    
9581588 tggaagtttcctgggtcgatcccaccgtttttctgtgcagcgttcaggcttgttgtgtgtggcttccttgcggcctagca 9581509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 131 - 210
Target Start/End: Complemental strand, 9587283 - 9587204
Alignment:
131 tggaagtttcttgggtcgatcccaccatttttctgtgcagcctccaggcttgttttttgcggcttccttgcggcctagca 210  Q
    |||||||||| ||||||||||||||| |||||||||||||| | |||||||||| | || ||||||||||||||||||||    
9587283 tggaagtttcctgggtcgatcccaccgtttttctgtgcagcgttcaggcttgttgtgtgtggcttccttgcggcctagca 9587204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 9581670 - 9581590
Alignment:
20 gtatcgtcgctgatgcttatgtggttctgtttttggctcatccgggtctatttttctggtctgctgttg-ctgtttttctggt 101  Q
    ||||||||||||||| || |||||||||| |||||||||||| ||  ||  |||||||||||||||||| |||||||||||||    
9581670 gtatcgtcgctgatgattctgtggttctg-ttttggctcatctggtgct-gttttctggtctgctgttgcctgtttttctggt 9581590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 9587365 - 9587285
Alignment:
20 gtatcgtcgctgatgcttatgtggttctgtttttggctcatccgggtctatttttctggtctgctgttg-ctgtttttctggt 101  Q
    ||||||||||||||| || |||||||||| |||||||||||| ||  ||  |||||||||||||||||| |||||||||||||    
9587365 gtatcgtcgctgatgattctgtggttctg-ttttggctcatctggtgct-gttttctggtctgctgttgcctgtttttctggt 9587285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 9602248 - 9602207
Alignment:
20 gtatcgtcgctgatgcttatgtggttctgtttttggctcatc 61  Q
    |||||||||||||||| ||| ||||| |||||||||||||||    
9602248 gtatcgtcgctgatgcatatatggttttgtttttggctcatc 9602207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 9606133 - 9606092
Alignment:
20 gtatcgtcgctgatgcttatgtggttctgtttttggctcatc 61  Q
    ||||||| ||||||||||||||  ||||||||||||||||||    
9606133 gtatcgttgctgatgcttatgtccttctgtttttggctcatc 9606092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University