View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_92 (Length: 339)
Name: NF20633_high_92
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_92 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 229
Target Start/End: Original strand, 41101035 - 41101245
Alignment:
| Q |
14 |
agatgaagacaccatccaggtagctattgatttgtatgttgttgattctattctattctattttatcaatattatcaactcaaaacacacacacagtgca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41101035 |
agatgaagacaccatccaggtagctattgatttgtatgttgttgattctatactattctattttatcaatattatcaactcaaaacacacacacac---- |
41101130 |
T |
 |
| Q |
114 |
aatagggaaaatgatgattgatccatttcatgtaatcacttgatacaaagttacaaactactgttgttggtgagaatattaagcctaaatatcgttttta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41101131 |
-atagggaaaatgatgattgatccatttcatgtaatcacttgatacaaagttacaaactactgttgttggtgagaatattaagcctaaatatcgttttta |
41101229 |
T |
 |
| Q |
214 |
agatttaggtttagat |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41101230 |
agatttaggtttagat |
41101245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 225 - 323
Target Start/End: Original strand, 41101265 - 41101363
Alignment:
| Q |
225 |
tagatagagattaatttctatgcactgacaagtaaaatatttgcatcatacggtcatttgattagatgcttgtgtaaaaatgtttcacaccgtcaatgt |
323 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41101265 |
tagatagagatcaatttctatgcactgacaagtaaaatatttgcatcatactgtcatttgattagatgcttgtgtaaaaatgtttcacaccgtcaatgt |
41101363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 155
Target Start/End: Original strand, 41079496 - 41079531
Alignment:
| Q |
120 |
gaaaatgatgattgatccatttcatgtaatcacttg |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41079496 |
gaaaatgatgattgatacatttcatgtaatcacttg |
41079531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 230
Target Start/End: Original strand, 41079547 - 41079593
Alignment:
| Q |
184 |
tgagaatattaagcctaaatatcgtttttaagatttaggtttagata |
230 |
Q |
| |
|
||||||||||| ||||| ||||||||||| || |||||||||||||| |
|
|
| T |
41079547 |
tgagaatattatgcctagatatcgttttttaggtttaggtttagata |
41079593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University