View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_118 (Length: 300)
Name: NF20633_low_118
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_118 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 5284104 - 5284328
Alignment:
| Q |
17 |
aaagtgtttagttttcaaaattatcatctggattttcaggattgtttttcctt--agagtggaattttaaaaggggtttcagaaaccctagaattgtcat |
114 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||| |||| |||||| || |||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
5284104 |
aaagtgtttagtttccataattatcatctgggttttcaagattttttttcttttaagagtggaatttcaaaaggggtttcagaaaccctagaattttcat |
5284203 |
T |
 |
| Q |
115 |
tttgtgattgaaatggcttcaggggcaattttcttatcgctgcggcggcgaagatcacctgcattggaagcttttctagctcccgttgaattaagcgacg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5284204 |
tttgtgattgaaatggcttcaggggcaattttctcatcgctgcggcggcgaagatcacctacattggaagcttttctagctcccgttgatttaagcgacg |
5284303 |
T |
 |
| Q |
215 |
ttgctttggttcaaacgattgtaac |
239 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
5284304 |
ttgctttggttcaaacccttgtaac |
5284328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University