View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_119 (Length: 300)
Name: NF20633_low_119
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_119 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 16404790 - 16404579
Alignment:
| Q |
14 |
actataccatttttctattaaataacccttagatccaaaaataattgttttggtaaatctcgagtttgatctttgattaaaataatcttttttagatttt |
113 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16404790 |
actataccatttttctattaaatacctcttagatccaaaaataattgtcttggtaaatctcgagtttgatctttgattaaaataatcttttttagatttt |
16404691 |
T |
 |
| Q |
114 |
acctatatttttgaacaagctctaaattatcaaagaatagttgaaaatttatgattaactccaaaaactgtttactcacaaaaataataatttggtgcct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
16404690 |
acctatatttttgaacaagctctaaattatcaaagaatagttgaaaatttatgattaactccaaaaactgtttactcacaaaaataataattt-gtgtct |
16404592 |
T |
 |
| Q |
214 |
ctatttgtcaatt |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
16404591 |
ctatttgtcaatt |
16404579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University