View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_123 (Length: 293)
Name: NF20633_low_123
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_123 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 287
Target Start/End: Original strand, 45667504 - 45667773
Alignment:
| Q |
18 |
agtatttactactttatttgcatatgttgtctggtaagataggatgcagaactgcaatttagaggacagcgtatttgggcagctgcaatggaagatttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45667504 |
agtatttactactttatttgcatatgttgtctggtaagataggatgcagaactgcaatttagaggacagcgtatttgggcagctgcaatggaagatttga |
45667603 |
T |
|
| Q |
118 |
tgtcaaagggaatgcattttgcaaatcaagctcttctttccggatgttccgcgggtggcctagcaactattatacactgcgatgaatttcgaggtctctt |
217 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45667604 |
tatcaaagggaatgcattttgctaatcaagctcttctttccggatgttccgctggtggcctagcaactattatacactgcgatgaatttcgaggtctctt |
45667703 |
T |
|
| Q |
218 |
tccaaggactactaaagtgaagtgtctaagcgatgcagggttgtttcttgattcgtaagcaacaaacaaa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45667704 |
tccaaggactactaaagtgaagtgtctaagcgatgcagggttgtttcttgattcgtaagcaacaaacaaa |
45667773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 147 - 266
Target Start/End: Complemental strand, 37972667 - 37972548
Alignment:
| Q |
147 |
gctcttctttccggatgttccgcgggtggcctagcaactattatacactgcgatgaatttcgaggtctctttccaaggactactaaagtgaagtgtctaa |
246 |
Q |
| |
|
||||||||||| ||||| || || ||||| || || |||||| |||||||||||||||||||||||| || ||||||||||| ||||||||||| || | |
|
|
| T |
37972667 |
gctcttctttctggatgctcagctggtggtcttgctactattttacactgcgatgaatttcgaggtcatttcccaaggactaccaaagtgaagtgcctca |
37972568 |
T |
|
| Q |
247 |
gcgatgcagggttgtttctt |
266 |
Q |
| |
|
| ||||| ||||| |||||| |
|
|
| T |
37972567 |
gtgatgctgggttatttctt |
37972548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 70 - 139
Target Start/End: Complemental strand, 37972826 - 37972757
Alignment:
| Q |
70 |
tgcaatttagaggacagcgtatttgggcagctgcaatggaagatttgatgtcaaagggaatgcattttgc |
139 |
Q |
| |
|
||||||| ||||||||||| |||||| |||||| |||| |||||||||||||| ||||||| |||||| |
|
|
| T |
37972826 |
tgcaattcagaggacagcgcatttggttggctgcagtggaggatttgatgtcaaaaggaatgcgttttgc |
37972757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University