View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_137 (Length: 269)
Name: NF20633_low_137
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_137 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 4957819 - 4958060
Alignment:
| Q |
12 |
tattctttatgtaaatatgccaactacaaaggttcttaaagaggcaaaataagacaggcaagacaaaattgaaaaggacgcaagataacaagatttgaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4957819 |
tattctttatgtaaatatgccaactacaaaggttcttaaagaggcaaaataagacaggcaagacaaaattgaaaaggacgcaagataacaagatttgaac |
4957918 |
T |
 |
| Q |
112 |
atacaacccatctctttagccaatattgtcttcaatagtgatcaagcaaacacacactctactatgtacattggatttagatgaaggatctaaaagtctt |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4957919 |
atacaacccatctctttagccgatattgtcttcaatagtgatcaagcaaacacacactctaccatgtacattggatttagatgaaggatctaaaagtctt |
4958018 |
T |
 |
| Q |
212 |
tttaatcccatgtatggagacatgcaaacc-ggacattcatg |
252 |
Q |
| |
|
|||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
4958019 |
tttaatcccatggatggagacatacaaaccgggacattcatg |
4958060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University