View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_141 (Length: 266)
Name: NF20633_low_141
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_141 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 36 - 169
Target Start/End: Complemental strand, 31845867 - 31845737
Alignment:
| Q |
36 |
attggatatgatactaataactcaataataaggattagccttattacctctaacaaaatatcagttgttagatgaatctaactagatcaattctctagtt |
135 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
31845867 |
attggatatgatactaa---ctcaataataaggactagccttattaactctaacaaaatatcagttgttagatgaatctaactagatcgatactctagtt |
31845771 |
T |
|
| Q |
136 |
tgttagattcccacaaaagttgggattcgagtgg |
169 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
31845770 |
tgttagattcccacaaaagttgggatttgagtgg |
31845737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 173 - 247
Target Start/End: Complemental strand, 31845768 - 31845694
Alignment:
| Q |
173 |
ttagattcccacatgagttgggatttgagtggaacggatgtagggatcatgtcctgctcaataaacattttaaga |
247 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31845768 |
ttagattcccacaaaagttgggatttgagtgggacggatgtagggatcatgtcctgctcaataaacattttaaga |
31845694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University