View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_142 (Length: 266)
Name: NF20633_low_142
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_142 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 177
Target Start/End: Complemental strand, 4952794 - 4952630
Alignment:
| Q |
12 |
atgagaatcgacatcacaactatgctcacactttagattctcaacaatcatttacaatatactctcaaatcttatcaataaaaataagaaggaaaaagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4952794 |
atgagaatcgacatcacaactatgctcacactttagattctcaacaatcatttacaatatactctcaaatcttatcaataaaaataagaaggaaaaagaa |
4952695 |
T |
 |
| Q |
112 |
atacactttaaagttttaaattttaaaacatgcactcaaaaccggtttattcgctatggtaatcaa |
177 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4952694 |
atacactttaaaattttaaattttaaaacatgcactcaaaatcgg-ttattcgctatggtaatcaa |
4952630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 209 - 251
Target Start/End: Complemental strand, 4952594 - 4952552
Alignment:
| Q |
209 |
agatggaggaggaaatgattcgtcgccattattttagtgttag |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4952594 |
agatggaggaggaaatgattcatcgccattattttagtgttag |
4952552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University