View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_144 (Length: 262)
Name: NF20633_low_144
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_144 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 171
Target Start/End: Complemental strand, 36781698 - 36781545
Alignment:
| Q |
18 |
attaggctacctgacattagatcaaagagcataattgtggagtcttaaagaatagaatggcaaattaggtcttgatcaagcatacaaagccaaaagaaaa |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36781698 |
attaggctacctgacatgagatcaaagagcataattgtggagtcttaaagaatagaatggcaaattaggttttgatcaagcatacaaagccaaaagaaaa |
36781599 |
T |
 |
| Q |
118 |
taagttgaaatcatacaaaacgtgaataatttatttaaattgtcacgtcatcaa |
171 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36781598 |
taagttgaaatgatacaaaacgtgaataatttatttaaattgtcacgtcatcaa |
36781545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University