View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_150 (Length: 258)
Name: NF20633_low_150
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_150 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 52 - 241
Target Start/End: Original strand, 54241880 - 54242068
Alignment:
| Q |
52 |
tctccaagaagggaaaagtggcaaaaaatcattaggaagtcatgtgttttgattgtattacaccttgcatgtgtgtgggttcctcataccaattaagctt |
151 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54241880 |
tctccaagaagggaaaagtggcaaaa-atcattaggaagtcatgtgttttgattgtattacaccttgcatgtgtgtgggttcctcataccaattaagctt |
54241978 |
T |
 |
| Q |
152 |
ctctgtattgcagtctagagtctagacacagagtgttaaaagaccaacactcccaaatatggagatctatggtggggttctcattaattt |
241 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54241979 |
ctgtatattgcagtctagagtctagacacagagtgttaaaaggccaaaactcccaaatatggagatctatggtggggttctcattaattt |
54242068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University