View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_155 (Length: 252)
Name: NF20633_low_155
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_155 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 37709536 - 37709763
Alignment:
| Q |
9 |
agcataggttaactgaaaccataaagattagaaagaggattatttgacttagggcataccgaaaccatgcatgtttttgaagcaaaagtcctagttaaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37709536 |
agcataggttaactgaaaccataaagattagaaagaggattatttgacttagggcataccgaaaccatgcatgtttttgaagcaaaagtcctagttaaac |
37709635 |
T |
 |
| Q |
109 |
catgagttaaagaattttctctcaatcactcaatggatcactgaagccaattcacacaaaacttggaatatttgtgaatgacacatttaaaatcacatgc |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37709636 |
catgagtttaagaattttctctcaatcactcaatggatcactgaagccaattcacacaaaacttggaatatttgtgaatgacacatttaaaatcacatgc |
37709735 |
T |
 |
| Q |
209 |
actatgtgatatttaattctgatctttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37709736 |
actatgtgatatttaattctgatctttt |
37709763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University