View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_157 (Length: 251)
Name: NF20633_low_157
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_157 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 39936374 - 39936136
Alignment:
| Q |
1 |
ctaaacgtcagtttaccttattagatcgaggtataagttcttgcagagctttcatcttttcattaatccgatcacggcgcctctgcatagaaatgcaatg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936374 |
ctaaacgtaagtttaccttattagatcgaggtataagttcttgcagagctttcatcttttcattaatccgatcacggcgcctctgcatagaaatgcaatg |
39936275 |
T |
 |
| Q |
101 |
tgaaaactttaatgttatgaggaaagcagaataaaatatgtaaactcaaagaaatgtgcgtcaaaactaccaacccgctctgagagattatggacctcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936274 |
tgaaaactttaatgttatgaggaaagcagaataaaatatgtaaactcaaacaaatgtgtgtcaaaactaccaacccgctctgagagattatggacctcag |
39936175 |
T |
 |
| Q |
201 |
cagcacgagatctctttgtagatgatccactgatatttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936174 |
cagcacgagatctctttgtagatgatccactgatatttt |
39936136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 29731712 - 29731749
Alignment:
| Q |
30 |
ggtataagttcttgcagagctttcatcttttcattaat |
67 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
29731712 |
ggtataagttcttgcaaagctttcatcttttcgttaat |
29731749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 29731844 - 29731889
Alignment:
| Q |
173 |
acccgctctgagagattatggacctcagcagcacgagatctctttg |
218 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
29731844 |
accctctctgagagattatgaacctctgcagcacgggatctctttg |
29731889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University