View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_164 (Length: 249)
Name: NF20633_low_164
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_164 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 11 - 175
Target Start/End: Original strand, 41820683 - 41820847
Alignment:
| Q |
11 |
caaagggtttcgtgtgcgcttaattagacactgctacttaatatggttgtgtcacaatatattttttattcttcatgtggtgtgtggattttgtactttt |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41820683 |
caaagggtttcgtgtgcgcttaaatagacactgctacttaatatggttgtgtcacaatatattttttattcttcatgtggtgtgtggattttgtactttt |
41820782 |
T |
 |
| Q |
111 |
tggtatattctctctagcacttgctatttgtttttgcatatgaacatttcgttcatacttgattg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41820783 |
tggtatattctctctagcacttgctatttgtttttgcctatgaacatttcgttcatacttgattg |
41820847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 47 - 174
Target Start/End: Complemental strand, 44829628 - 44829501
Alignment:
| Q |
47 |
cttaatatggttgtgtcacaatatattttttattcttcatgtggtgtgtggattttgtactttttggtatattctctctagcacttgctatttgtttttg |
146 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44829628 |
cttaatatgattgtgtcacactatattttttattcttcatgtggtgtgtggattttgtactttttggtatattctctctagcacttgttatttatttttg |
44829529 |
T |
 |
| Q |
147 |
catatgaacatttcgttcatacttgatt |
174 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
44829528 |
ccaatgaacatttcgttcatacttgatt |
44829501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 41820875 - 41820921
Alignment:
| Q |
203 |
gtgatggtttgaaattgaagcatctttgtcttcttattcatggtctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41820875 |
gtgatggtttgaaattgaagcatctttgtcttcttattcatggtctc |
41820921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 203 - 243
Target Start/End: Complemental strand, 44829485 - 44829445
Alignment:
| Q |
203 |
gtgatggtttgaaattgaagcatctttgtcttcttattcat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44829485 |
gtgatggtttgaaattgaagcatctttgtcttctttttcat |
44829445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University