View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_171 (Length: 246)
Name: NF20633_low_171
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_171 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 76 - 231
Target Start/End: Original strand, 34007325 - 34007479
Alignment:
| Q |
76 |
tgttgtcattatccttatctaaacactaataggagagcactagcatggcttgcagtcataaaaatgtttttctatgttaagataacaaaccaatgtggta |
175 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34007325 |
tgttgtcattatccttatcaaaccactaataggagagcactagcatggca--cagtcataaaaatgtttttctatgttaagataacaaaccaatgtggta |
34007422 |
T |
 |
| Q |
176 |
aattgcat-ggcagatattgacaacaataatcatacatactttgtccttggaacttg |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34007423 |
aattgcatgggcagatattgacaacaataatcatacatactttgtccttggaacttg |
34007479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University