View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_177 (Length: 243)
Name: NF20633_low_177
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_177 |
 |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 5 - 175
Target Start/End: Complemental strand, 17068922 - 17068753
Alignment:
| Q |
5 |
aatcgaagcaatgacttaattatttacttattgctttctgcataatatgaaaattgcaaagttagtgaacctagacgaaacatgggccaaaagggaatta |
104 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17068922 |
aatcgaagcaatgacttaattatt-acttattgctttctgcataatatgaaaattgcaaagttagtgaacctagacgaaacatgggccaaaagtgaatta |
17068824 |
T |
 |
| Q |
105 |
gtagcacgagaatatgataaaaacatccgatatcaaagccacgttctattatactatgttttgccatgtct |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||| |
|
|
| T |
17068823 |
gtagcacgagaatatgataaaaacatccgatatcaaagccacattctattacactatgttttgctatgtct |
17068753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 235
Target Start/End: Original strand, 1257153 - 1257190
Alignment:
| Q |
198 |
ggggttcgaaccccagatctttcatattttatgcattg |
235 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
1257153 |
ggggttcgaaccccagaccttacatattttatgcattg |
1257190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 236
Target Start/End: Original strand, 12611036 - 12611072
Alignment:
| Q |
200 |
ggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12611036 |
ggttcgaaccccagaccttgcatattttatgcattgt |
12611072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 17068741 - 17068693
Alignment:
| Q |
192 |
gagatcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
||||| || |||||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
17068741 |
gagattggagttcgaaccccaaatcttttatattttatgtattgttcat |
17068693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 240
Target Start/End: Original strand, 31708147 - 31708187
Alignment:
| Q |
200 |
ggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
31708147 |
ggttcgaaccccagaccttgcatatattatgcattgttcat |
31708187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 196 - 240
Target Start/End: Original strand, 29133481 - 29133525
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29133481 |
tcggggttcgaaccctagatcttgcatattttatgcattgttcat |
29133525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 240
Target Start/End: Original strand, 10560331 - 10560377
Alignment:
| Q |
194 |
gatcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||||| |||||||||| |
|
|
| T |
10560331 |
gatcggggttcgaacccctgaccttgcatattttatacattgttcat |
10560377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 238
Target Start/End: Original strand, 25274826 - 25274868
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgttc |
238 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
25274826 |
tcggggttcgaaccccagaccttacatatattatgcattgttc |
25274868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 42475107 - 42475148
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgtt |
237 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
42475107 |
tcggggttcgaacctcagaccttgcatattttatgcattgtt |
42475148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 189 - 240
Target Start/End: Original strand, 28244094 - 28244145
Alignment:
| Q |
189 |
gtggagatcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
|||| |||||||||||||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
28244094 |
gtggtgatcggggttcgaaccccggaccttgcatattttatgcattgttcat |
28244145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 52576011 - 52575967
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
52576011 |
tcgggattcgaaccccagaccttgcatattttatgcattgttcat |
52575967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 201 - 238
Target Start/End: Original strand, 19939043 - 19939080
Alignment:
| Q |
201 |
gttcgaaccccagatctttcatattttatgcattgttc |
238 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
19939043 |
gttcgaaccccagacctttcatatattatgcattgttc |
19939080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 201 - 240
Target Start/End: Original strand, 26885640 - 26885679
Alignment:
| Q |
201 |
gttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
26885640 |
gttcgaaccccggatcttacatattttatgcattgttcat |
26885679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 240
Target Start/End: Original strand, 1764953 - 1764995
Alignment:
| Q |
198 |
ggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
1764953 |
ggggttcgaaccccggatcttgcatattttatgcgttgttcat |
1764995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 238
Target Start/End: Original strand, 4756967 - 4757009
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgttc |
238 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
4756967 |
tcggggttcgaacccaagatattgcatattttatgcattgttc |
4757009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 236
Target Start/End: Original strand, 26886042 - 26886079
Alignment:
| Q |
199 |
gggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
26886042 |
gggttcgaaccccggatcttacatattttatgcattgt |
26886079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 236
Target Start/End: Complemental strand, 44293636 - 44293599
Alignment:
| Q |
199 |
gggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
44293636 |
gggttcgaaccccagatcttacatatattatgcattgt |
44293599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 236
Target Start/End: Complemental strand, 15188959 - 15188923
Alignment:
| Q |
200 |
ggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
15188959 |
ggttcgaaccccagatcttacatatattatgcattgt |
15188923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 30623357 - 30623317
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
30623357 |
tcggggttcgaaccccagaccttgcatatattatgcattgt |
30623317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 236
Target Start/End: Complemental strand, 39076592 - 39076544
Alignment:
| Q |
188 |
ggtggagatcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||| |||| ||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
39076592 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
39076544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 236
Target Start/End: Complemental strand, 39077078 - 39077030
Alignment:
| Q |
188 |
ggtggagatcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||| |||| ||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
39077078 |
ggtggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
39077030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 240
Target Start/End: Complemental strand, 9111113 - 9111067
Alignment:
| Q |
194 |
gatcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
|||||||||||||||||| || ||| ||||| ||||||||||||||| |
|
|
| T |
9111113 |
gatcggggttcgaaccccggaccttgcatatattatgcattgttcat |
9111067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 238
Target Start/End: Complemental strand, 12808931 - 12808891
Alignment:
| Q |
198 |
ggggttcgaaccccagatctttcatattttatgcattgttc |
238 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
12808931 |
ggggttcgaaccccagaccttgcatatattatgcattgttc |
12808891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 236
Target Start/End: Original strand, 29233973 - 29234011
Alignment:
| Q |
198 |
ggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
29233973 |
ggggttcgaaccccagaccttgcatattttatgcattgt |
29234011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 11410691 - 11410647
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
11410691 |
tcgggattcgaaccccagaccttacatattttatgtattgttcat |
11410647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 37050993 - 37050949
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgttcat |
240 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||||||| ||||| |
|
|
| T |
37050993 |
tcggggttcgaaccccggaccttgcatattttatgcattattcat |
37050949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 40227893 - 40227853
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
40227893 |
tcggggttcgaaccccagaccttgtatattttatgcattgt |
40227853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 5477 - 5437
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5477 |
tcggggatcgaaccccagaccttgcatattttatgcattgt |
5437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 53377 - 53417
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
53377 |
tcggggtttgaaccccagaccttgcatattttatgcattgt |
53417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 580923 - 580963
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
580923 |
tcggggttcgaacgccggatcttgcatattttatgcattgt |
580963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 236
Target Start/End: Original strand, 10303512 - 10303548
Alignment:
| Q |
200 |
ggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
10303512 |
ggttcgaaccccggatcttgcatattttatgcattgt |
10303548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 236
Target Start/End: Original strand, 12671749 - 12671785
Alignment:
| Q |
200 |
ggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
12671749 |
ggttcgaaccccggatcttgcatattttatgcattgt |
12671785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 32180894 - 32180854
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
32180894 |
tcggggttcgaaccccagactttgcatattttatgcattgt |
32180854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 47806253 - 47806293
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
47806253 |
tcggggttcgaaccccagaccttgcatatattatgcattgt |
47806293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 56564980 - 56565020
Alignment:
| Q |
196 |
tcggggttcgaaccccagatctttcatattttatgcattgt |
236 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
56564980 |
tcggggttcgaaccctagaccttgcatattttatgcattgt |
56565020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University