View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20633_low_186 (Length: 239)

Name: NF20633_low_186
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20633_low_186
NF20633_low_186
[»] chr6 (2 HSPs)
chr6 (100-222)||(500659-500780)
chr6 (1-48)||(500561-500608)


Alignment Details
Target: chr6 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 100 - 222
Target Start/End: Original strand, 500659 - 500780
Alignment:
100 ggattagctaaagtataaaaacaatcaannnnnnnnnactaagataacttgtaaaatctctcacagacaaaaaagaaacttataaatcattttgaatttt 199  Q
    |||||||||||||||||| |||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
500659 ggattagctaaagtataagaacaatcaatttttttt-actaagataacttgtaaaatctctcacagacaaaaaagaaacttataaatcattttgaatttt 500757  T
200 ttatgaacgcacacatatctaat 222  Q
    |||||||||||||||||||||||    
500758 ttatgaacgcacacatatctaat 500780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 500561 - 500608
Alignment:
1 tagaatatccatctgatgatgaagctcatcgaaaaattatggtactaa 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
500561 tagaatatccatctgatgatgaagctcatcgaaaaattatggtactaa 500608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University