View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20633_low_188 (Length: 238)

Name: NF20633_low_188
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20633_low_188
NF20633_low_188
[»] chr3 (2 HSPs)
chr3 (1-160)||(193169-193328)
chr3 (153-223)||(193074-193144)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 193328 - 193169
Alignment:
1 aaaagaataataacaataattcacaacagaataacacgtcagtcactcttgttcctattatcttaataaacctcaagtggattgaaatttatcctaaaaa 100  Q
    ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
193328 aaaagaataataataataatttacaacagaataacacgtcagtcactcttgttcctattatcttaataaacctcaagtggattgaaatttatcctaaaag 193229  T
101 taatatagaatttacaatttttcaatgtcgatggggtacccacgctacccatggcgggga 160  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
193228 taatatagaatttacaatttttcaatgtcgatggggtacccacgctacccatggtgggga 193169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 193144 - 193074
Alignment:
153 ggcggggacagccagacagggggagcactccccacccccgccttgccccattgacatccctacttttccct 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
193144 ggcggggacagccagacagggggagcactccccacccccgccttgccccattgacatccctacttttccct 193074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University