View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_192 (Length: 238)
Name: NF20633_low_192
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_192 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 51486854 - 51486636
Alignment:
| Q |
1 |
ctaaaacctataactttaacataagcagtaccatcctccaagacctgactccaacgcatgattgcaatcctaaattagagttgtttgcatattttgaaca |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51486854 |
ctaaaacccataactttaacataagcagtaccatcctccaagacctgactccaacacatgattgcaatcctaaattagagttgtttgcatattttgaaca |
51486755 |
T |
 |
| Q |
101 |
atactagataatacaataaagaaataaaaatacaaaatcaacaagaaacctttatgtctttactagagcgcttttagtgattttcaaagnnnnnnngcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
51486754 |
atactagataatacaataaagaaataaaaatacaaaatcaacaagaaacctttatgtctttactaga--gcttttagtgattttcaaagaaaaatagcaa |
51486657 |
T |
 |
| Q |
201 |
ttgaaagtacagattgtctac |
221 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
51486656 |
ttgaaagtacaaattgtctac |
51486636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University