View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_197 (Length: 237)
Name: NF20633_low_197
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_197 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 53346226 - 53346003
Alignment:
| Q |
1 |
tgacaaccacgggtaatattttgtggaaattatagcctataatgtaaataattgtatttgctattatgtaactgtaaagttgctggttatcacgagacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53346226 |
tgacaaccacgggtaatattttgtggaaattatagcctataatgtaaataattgtatgtgctattatgtaactgtaaagttgctggttatcacgagacac |
53346127 |
T |
 |
| Q |
101 |
gaaagtatatacagaaagaacnnnnnnncttcaatctattaccagttggtcttgaaatagactagtaatgaagtatgaaaattcttgtctctaac----a |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53346126 |
gaaagtatatacagaaagaacaaaaaaacttcaatctattaccagttggtcttgaaatagactagtaatgaagtatgaaaattcttgtctctaacaatta |
53346027 |
T |
 |
| Q |
197 |
attataaaggttttagcactgtaa |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53346026 |
attataaaggttttagcactgtaa |
53346003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University