View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_206 (Length: 233)
Name: NF20633_low_206
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_206 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 11 - 167
Target Start/End: Original strand, 26460765 - 26460921
Alignment:
| Q |
11 |
atcatcacgagggtcttcttagtgtgaagagggagaagatcgtttgtaacgctgccctctgcaagttaggttgcggttctatgcttccggtatcctttct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||||||||| |||||| |
|
|
| T |
26460765 |
atcatcacgagggtcttcttagtgtgaagagggagaagatcatttgtaacgctgccctctgtaagttaggttgcagttctaaacttccggtattctttct |
26460864 |
T |
 |
| Q |
111 |
ctccctctcttttttgatatatcagtctttaatcttttatacttacatctcttatga |
167 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
26460865 |
ctccctctcttttttaatagattagtctttaatcttgtatgcttacatctcttatga |
26460921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 11 - 167
Target Start/End: Original strand, 29679548 - 29679704
Alignment:
| Q |
11 |
atcatcacgagggtcttcttagtgtgaagagggagaagatcgtttgtaacgctgccctctgcaagttaggttgcggttctatgcttccggtatcctttct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |||||||||| |||||| |
|
|
| T |
29679548 |
atcatcacgagggtcttcttagtgtgaagagggagaagattatttgtaacgctgccctctgtaagttaggttgcagttctaaacttccggtattctttct |
29679647 |
T |
 |
| Q |
111 |
ctccctctcttttttgatatatcagtctttaatcttttatacttacatctcttatga |
167 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
29679648 |
ctccctctcttttttaatagattagtctttaatcttgtatgcttacatctcttatga |
29679704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 11489700 - 11489589
Alignment:
| Q |
11 |
atcatcacgagggtcttcttagtgtgaagagggagaagatcgtttgtaacgctgccctctgcaagttaggttgcggttctatgcttccggtatcctttct |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| ||||||||||||| || || |||||||||| |||||| |
|
|
| T |
11489700 |
atcaccacgagggtcttcttagtgtgaagagggagaagatcatttgtaatgctgcgctctctaagttaggttgcgattttagacttccggtattctttct |
11489601 |
T |
 |
| Q |
111 |
ctccctctcttt |
122 |
Q |
| |
|
||||||||||| |
|
|
| T |
11489600 |
ttccctctcttt |
11489589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University