View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_207 (Length: 229)
Name: NF20633_low_207
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_207 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 6 - 149
Target Start/End: Original strand, 2356640 - 2356786
Alignment:
| Q |
6 |
ataaactacgcaaattatcgcataaaa---tgttataagttagtgcaaatnnnnnnntgtttatgacttctattcggtgttatcaacttatcattttcct |
102 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2356640 |
ataaactacgtaaattatcgtataaaaaaatgttacaagttagtgcaaataaaaaaatgtttatgacttctattcggtgttatcaacttatcattttcct |
2356739 |
T |
|
| Q |
103 |
ttcctataagatgcacatcgactgttttggaagtaaaaccaaacaca |
149 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
2356740 |
ttcctataagatgcacatcgactgtttcgaaagtgaaaccaaacaca |
2356786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 185 - 229
Target Start/End: Original strand, 2356878 - 2356922
Alignment:
| Q |
185 |
atcctttcaaaaattaattacttcatagatgtttctgatcaacat |
229 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2356878 |
atccttccaaaaattaattacttcatagatgtttctgatcaacat |
2356922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University