View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_208 (Length: 228)
Name: NF20633_low_208
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_208 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 5479842 - 5480032
Alignment:
| Q |
19 |
agaaccgctgaaaagagacaggtgtcgctcgctgattgggggagatattgtcacaaaaatgggatgttggggagtattgtagacccgtcggtgaagtgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5479842 |
agaaccgctgaaaagagacaggtgtcgctcgctgattgggggagatattgtcataaaaatgggatgttggggagtattgtggacccgtcggtgaagtgga |
5479941 |
T |
 |
| Q |
119 |
gtatagcaccggagtgtttgaggaaattcggggagattgcagttagttgtttgttggatgatggaaccatgagaccgtcgatgaatgatgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5479942 |
gtatagcaccggagtgtttgaggaaattcggggagattgcagttagttgtttgttggatgatggaaccatgagaccgtcgatgaatgatgt |
5480032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University