View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_209 (Length: 226)
Name: NF20633_low_209
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_209 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 43538523 - 43538719
Alignment:
| Q |
16 |
tatacgtcactacatctggcttgatcccaaattcttccattaatgtcaatgcctggccagattttactggtaggttactatctttatcacaaatcaagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538523 |
tatacgtcactacatctggcttgatcccaaattcttccattaatgtcaatgcctggccagattttactggtaggttactatctttatcacaaatcaagat |
43538622 |
T |
 |
| Q |
116 |
actgactaattaaaggccagcatgatataacgagtatagaaaatcaatttcgaaataggtggttgatatcttggagtattaatcttgctagtattat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43538623 |
actgactaattaaaggccagcatgatataacgagtatagaaaatcaatttcgaaataggtggttgatatcttggagtattaatcttgctagtcttat |
43538719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University