View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_210 (Length: 226)
Name: NF20633_low_210
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_210 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 103 - 226
Target Start/End: Complemental strand, 48516964 - 48516841
Alignment:
| Q |
103 |
cttaatctacgatccatattggagaagactggaaagtgcgtttgaattgatctattcttaagaaataaaatgtgtgtactatgtcttaatatttatgcta |
202 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
48516964 |
cttaatcaatgatccatattggagaagactggaaagtgcgtttgaattgatctattcttaagaaataaaatgtttgtactgtgtcttaatatttacgcta |
48516865 |
T |
 |
| Q |
203 |
tccaaatccaagtcagtggtctaa |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48516864 |
tccaaatccaagtcagtggtctaa |
48516841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 48517099 - 48516999
Alignment:
| Q |
1 |
caaattattttaattttgttgcaatggctaaaagtcattnnnnnnnn-ttgaaactttgtgttaatacaataaaagatttctgtaactataaaagcatgc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48517099 |
caaattattttaattttgttgcaatggctaaaagtcattcaaaaaaaattgaaactttgtgttaatacaataaaagatttctgtaactataaaagcatgc |
48517000 |
T |
 |
| Q |
100 |
c |
100 |
Q |
| |
|
| |
|
|
| T |
48516999 |
c |
48516999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University