View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20633_low_212 (Length: 217)

Name: NF20633_low_212
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20633_low_212
NF20633_low_212
[»] chr4 (1 HSPs)
chr4 (1-201)||(250729-250929)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 250929 - 250729
Alignment:
1 cagggactctactctacatacaatgggtcatgcataggtgtatgccaaccattgagaaaatacgttgttataatcataggtgtaaaaatgaacacattta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
250929 cagggactctactctacatacaatgggtcatgcataggtgtatgccaaccattgagaaaatactttgttataatcataggtgtaaaaatgaacacattta 250830  T
101 attttcttgttctcattgggggtacccttttagtctctttacaaatttcttttttcaagtttgattggagtataacttgattttgcaaaccaagaattca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
250829 attttcttgttctcattgggggtacccttttagtctctttacaaatttcttttttcaagtttgattggagtataacttgattttgcaaaccaagaattca 250730  T
201 t 201  Q
    |    
250729 t 250729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University