View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20633_low_226 (Length: 204)

Name: NF20633_low_226
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20633_low_226
NF20633_low_226
[»] chr8 (1 HSPs)
chr8 (1-204)||(36785081-36785284)


Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 36785081 - 36785284
Alignment:
1 ctctggaaccatcgatttcatctttgggcattcaactaccttaatccaaaactccaaaataattgcgaggaagccgagtccaggccatagcaacgttgtg 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
36785081 ctctggaaccattgatttcatctttgggcattcaactaccttaatccaaaactccaaaataattgtgaggaagccgagtccaggccatagcaacgttgtg 36785180  T
101 gtggcagacggaacaaagcaaaagaatgccctaactggaatagtccttcaaaattgctcgatcatgccagatgttgaacttttacctgataggttgacag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
36785181 gtggcagacggaacaaagcaaaagaatgccctaactggaatagtccttcaaaattgctcgatcatgccagatgttgaacttttacctgataggttgacgg 36785280  T
201 tgaa 204  Q
    ||||    
36785281 tgaa 36785284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University