View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_38 (Length: 495)
Name: NF20633_low_38
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 1e-70; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 34647164 - 34647303
Alignment:
| Q |
19 |
gaagcagctaccaatggcatattcaactcttgggttaggtaacttatcaagttactgtgaaatccagcgcccgcaaatctatcacatacttcatttgctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34647164 |
gaagcagctaccaatggcatattcaactcttgggttaggtaacttatcaagttactgtgaaatccagcgcccgcaaatctatcacatacttcatttgctg |
34647263 |
T |
 |
| Q |
119 |
catgtacattgtcactcacatgtaaaatatttgccattga |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34647264 |
catgtacattgtcactcacatgtaaaatatttgtcattga |
34647303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 397 - 486
Target Start/End: Original strand, 34647382 - 34647471
Alignment:
| Q |
397 |
cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacagtataat |
486 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34647382 |
cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacaatataat |
34647471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 27 - 121
Target Start/End: Original strand, 34661337 - 34661431
Alignment:
| Q |
27 |
taccaatggcatattcaactcttgggttaggtaacttatcaagttactgtgaaatccagcgcccgcaaatctatcacatacttcatttgctgcat |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| | ||| |||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
34661337 |
taccaatggcatattcaactcttgagttaggtaacttatcaagttaccattaaaaccagtcaccgcaaatctatcacatacctcattagctgcat |
34661431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 28 - 121
Target Start/End: Original strand, 34667491 - 34667584
Alignment:
| Q |
28 |
accaatggcatattcaactcttgggttaggtaacttatcaagttactgtgaaatccagcgcccgcaaatctatcacatacttcatttgctgcat |
121 |
Q |
| |
|
||||||||||||||||| | ||| || ||||| |||||| ||| ||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
34667491 |
accaatggcatattcaattgttgtgtaaggtaggttatcatgtttgcatgaaatccagcgctcgcaaatctatcacacacttcatttgctgcat |
34667584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University