View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_39 (Length: 486)
Name: NF20633_low_39
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 9 - 468
Target Start/End: Complemental strand, 19746539 - 19746076
Alignment:
| Q |
9 |
agcacagatggatgggaggaagaagacgagactgatcctaaggtaccaggtctttcaatcggattattgtagagatcttcagttgaattatatgatgaat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19746539 |
agcacagatggatgggaggaagaagacgagactgatcctaaggtaccaggtctttaaatcggattattgtagagatcttcagttgaattatatgatgaat |
19746440 |
T |
 |
| Q |
109 |
actgttaaacattgctttaaagttggtgctcttctatgtccctatcttacatgtgtagattggtgatggaggaaatggtggtggggttgtcttgcaaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19746439 |
actgttaaacattgctttaaagttggtgctcttctatgtccctatcttacatgtgtagattggtgacggaggaaatggtggtggggttgtcttgcaaaat |
19746340 |
T |
 |
| Q |
209 |
gtgccatggggtcggcgagcccactctattgcggaggaggtccttgtgcagtttagtgaggacctgaaactattttctttcaagactagtccccgtggat |
308 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
19746339 |
gtgccatggggtcagcgagcccactctattgcggaggaggtccttgtgcagttcagtgaggacctcaaactatttgctttcaagactagtccccgtggat |
19746240 |
T |
 |
| Q |
309 |
atgtttacgtgagattggacaaattaacaaccaagtaatatttcaacttgtgcatatacatgtttagaatttctttacattcttttgattagcttgtcat |
408 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
19746239 |
atgtttacgtgagattggataaattaacaaccaagtaatatttcaacttgtgcatatatatgtttaaaatttctttacattcttttgattagcttgtcgt |
19746140 |
T |
 |
| Q |
409 |
tt----gtgggtagggacgtagggtgtgggttgttccaagagagtaaatggtgtgtgactagtc |
468 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19746139 |
ttgtgggtgggtagggacatagggtgtgggttgttccaagagagtcaatggtgtgtgactagtc |
19746076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University