View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20633_low_70 (Length: 394)

Name: NF20633_low_70
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20633_low_70
NF20633_low_70
[»] chr6 (1 HSPs)
chr6 (13-180)||(30927760-30927922)


Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 13 - 180
Target Start/End: Complemental strand, 30927922 - 30927760
Alignment:
13 aaaataaactgatttaaatgattgactagaaagtaagtaaaggcgggagtcgacccaaatcccaaaatcaaaattaaaacatcgggccccacatcacttc 112  Q
    ||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30927922 aaaataaactgatttaaatgattgacta-----aaagtaaaggcgggagtcgacccaaatcccaaaatcaaaattaaaacatcgggccccacatcacttc 30927828  T
113 cttctctcctctgtcacttaaaactttctgtttggctctctctttctctcttaaccttttcccatttg 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30927827 cttctctcctctgtcacttaaaactttctgtttggctctctctttctctcttaaccttttcccatttg 30927760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University