View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_73 (Length: 386)
Name: NF20633_low_73
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_73 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 52 - 370
Target Start/End: Complemental strand, 6179684 - 6179366
Alignment:
| Q |
52 |
gtgtggacgagagaaagagtttgatgctagaaacaacgagagatttgtggctctaattttgtaagagtgagaaagaaagtgtgagtgagaaaatcaacac |
151 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6179684 |
gtgtggatgagagaaagagtttgatgctagaaacaacgagagatttgtggctctaattttgtaagagtgagaaagaaagtgtgagtgagaaaatcaacac |
6179585 |
T |
|
| Q |
152 |
tcacaaaataaagcttagtagtataatgtgttcgtatatataagtggcaagaaaatgagattgagatagaggttctaggnnnnnnnnggtagtatatttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
6179584 |
tcacaaaataaagcttagtagtataatgtgttcgtatatataagtggcaagaaaatgagattgagatagaggttctaggtttattttggtagtagatttt |
6179485 |
T |
|
| Q |
252 |
agggttatcaatattgtggggctagttgcatatggtattattgaaggtgagtagtatctataggacaaacaattcaagttgggaccatgaagggttgtta |
351 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6179484 |
agggttacaaatattgtggggctagttgcatatggtattattgaaggtgactagtatctataggacaaacaattcaagttgggaccatgaaggattgtta |
6179385 |
T |
|
| Q |
352 |
ataattgacgtagagtttg |
370 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6179384 |
ataattgacgtagagtttg |
6179366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 12 - 45
Target Start/End: Complemental strand, 6179712 - 6179679
Alignment:
| Q |
12 |
agagatagatgcaagaaacattttgagagtgtgg |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6179712 |
agagatagatgcaagaaacattttgagagtgtgg |
6179679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University