View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_low_86 (Length: 354)
Name: NF20633_low_86
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_low_86 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 5479864 - 5479521
Alignment:
| Q |
1 |
acctgtctcttttcagcggttcttatcagtggtggccttgcgcacaatatctcaaacaaaacaacaccaaaagaataaacatcagatttctcagtcaaac |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||| |||||| |||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
5479864 |
acctgtctcttttcagcggttctaatcagtggtggtcttgcgcacagtatctcgaacaaaacaacaccaaaagagtaaacatcagatttctcggtcaaac |
5479765 |
T |
 |
| Q |
101 |
gctgacgtttataatactccgggtctaaatacccaacactccctttaacaaccgtactaacatgggctttcgaaatacccataggcccaatcctcgaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5479764 |
gctgacgtttataatactccgggtctaaatacccaacactccctttaacaaccgtactaacatgggcttttgaaatacccataggcccaatcctcgaaag |
5479665 |
T |
 |
| Q |
201 |
cccaaaatcggaaacctttgctatccatttatcatctaacagaatatttgtggttttcacatcacggtgaataatcatgttctttgcaccggtatgaagg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5479664 |
cccaaaatcggaaacctttgctatccatttatcatctaacagaatatttgtcgttttcacgtcacggtgaataatcatgttctttgcaccagtatgaagg |
5479565 |
T |
 |
| Q |
301 |
tagtgtaacccacgtgccgctccgattgaaatttgcaacctttg |
344 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5479564 |
tagtgtaacccacgtgccgctccaattgaaatttgcaacctttg |
5479521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University