View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_high_25 (Length: 373)
Name: NF20634_high_25
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 19 - 360
Target Start/End: Original strand, 42484699 - 42485040
Alignment:
| Q |
19 |
gtcccacaatatgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccacctcgcctgtggcttcgtcgacggtagtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42484699 |
gtcccacaatatgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccaccttgcctgtggcttcgtcgacggtagtg |
42484798 |
T |
 |
| Q |
119 |
tccgactcttcgatctccacaccggtgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcgggaatttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
42484799 |
tccgactcttcgatctccacaccggtgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcaggaattgt |
42484898 |
T |
 |
| Q |
219 |
aattggaagctctactctcgccttcgcaagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacga |
318 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484899 |
aattggaagctctactctcgccttcgcgagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacga |
42484998 |
T |
 |
| Q |
319 |
cgggcaattattggtgatgttgttaataacggagtattagta |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484999 |
cgggcaattattggtgatgttgttaataacggagtattagta |
42485040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University