View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_high_33 (Length: 296)
Name: NF20634_high_33
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 3 - 280
Target Start/End: Original strand, 53123812 - 53124088
Alignment:
| Q |
3 |
attgcagtgttatgtgcaaaaatgaacgagtggctgaaatgccaacgattcccttgcaagtgaaaaagaagtgtaaaacgcaacataatcacaaccataa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123812 |
attgcagtgttatgtgcaaaaatgaacgagtggctgaaatgccaacgattcccttgcaagtgaaaaagaagtgtaaaacgcaacataatcacaaccataa |
53123911 |
T |
 |
| Q |
103 |
cataattcaggctcagaaactctagcatgaggcatggatttcttaaccacttgaaaaccccgcatgcaaattgcatcaccacaatacaactttgtaaaag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123912 |
cataattcaggctcagaaactctagcatgaggcatggatttcttaaccacttgaaaaccccacatgcaaattgcatcaccacaatacaactttgtaaaag |
53124011 |
T |
 |
| Q |
203 |
actcgtcactacaaaataccaagtttttacactctattcatgggatgcaattggaacttggggagtggagcaggtaac |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53124012 |
actcgtcactacaaaataccaagtttttacactctattcatgggatgcaattggaactt-gggagtggagcaggtaac |
53124088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University