View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_high_46 (Length: 251)
Name: NF20634_high_46
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_high_46 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 41993136 - 41992913
Alignment:
| Q |
13 |
aatatccaagtcgtcagctatttacaccccaccatgaatcaaaggaagaagctaaagaagnnnnnnnnnnnnnnnnnnnntagaaagaaccaatcttgtt |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41993136 |
aatatccaagccgtcagctatttacaccccaccatgaatcaaaggaagaagctaaagaa---------------aaaaaatagaaagaaccaatcttgtt |
41993052 |
T |
|
| Q |
113 |
ctattttcatggaaccaagcttggaacttctaagtcttaaaaagatctcaacttaactaactacttagcatgtgtttggttgaacggtggacactgctac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41993051 |
ctattttcatggaaccaagcttggaacttctaagtcttaaaaagatctcaacttaactaactacttagcatgtgtttggttgaacggtggacactgctac |
41992952 |
T |
|
| Q |
213 |
cacgagttcaaagctctctcaatgcgaattttagaagtt |
251 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41992951 |
cacgagttcaaagcactctcaatgcgaattttagaagtt |
41992913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University