View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_high_47 (Length: 241)
Name: NF20634_high_47
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_high_47 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold1343 (1 HSPs) |
 |  |  |
|
| [»] scaffold0247 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 15)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 43 - 163
Target Start/End: Original strand, 22042701 - 22042822
Alignment:
| Q |
43 |
gtatcgttataaccaaaatgagtataatttaatagcttgat-aaaaaacacatatactatcaaactacttgtccatttgaaacattgtgtagactaaata |
141 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22042701 |
gtatcgttataaccgaaatgagtataatttaatagcttgatcaaaaaacacaaatactatcaaactacttctccagttgaaacattgtgtagactaaata |
22042800 |
T |
 |
| Q |
142 |
accgctatagaaataataaaaa |
163 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
22042801 |
acccttatagaaataataaaaa |
22042822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 50 - 157
Target Start/End: Complemental strand, 22016389 - 22016285
Alignment:
| Q |
50 |
tataaccaaaatgagtataatttaatagcttgataaaaaacacatatactatcaaactacttgtccatttgaaacattgtgtagactaaataaccgctat |
149 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||||||| ||| |||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
22016389 |
tataatcaaaatgagtatagtttaataggttgataaaaaacacaaata---tcaaactacttgtccatttgaaacatcgggtagactaaataacctctat |
22016293 |
T |
 |
| Q |
150 |
agaaataa |
157 |
Q |
| |
|
| |||||| |
|
|
| T |
22016292 |
acaaataa |
22016285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 10602019 - 10602060
Alignment:
| Q |
181 |
gttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
10602019 |
gttggcagagacatgcattgttatatgcaggggacggggttc |
10602060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 32527165 - 32527117
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
32527165 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
32527117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 3037705 - 3037662
Alignment:
| Q |
180 |
agttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3037705 |
agttggctgggacaatgcattgttatatgcaggggccggggttc |
3037662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 211
Target Start/End: Original strand, 34376555 - 34376586
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34376555 |
agttggcagggacatgcattgttatatgcagg |
34376586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 222
Target Start/End: Original strand, 36413780 - 36413815
Alignment:
| Q |
187 |
agggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36413780 |
agggacatgcattgttatatgcaggggccggagttc |
36413815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 44132650 - 44132603
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
44132650 |
agctcagttggcagagacatgcattgttatatgcagaggtcggggttc |
44132603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Complemental strand, 13294464 - 13294434
Alignment:
| Q |
182 |
ttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13294464 |
ttggcagggacatgcattgttatatgcaggg |
13294434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 14307776 - 14307734
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
14307776 |
agttggtagggacatgcattgttatatgcaggggtcgaggttc |
14307734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 26975380 - 26975338
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||| ||||||| |
|
|
| T |
26975380 |
agttggcagggacatgcattgctatatgcagaggctggggttc |
26975338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 39334963 - 39334921
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
39334963 |
agttggcagggacatgcattattatatacaggggctggggttc |
39334921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 29034990 - 29035031
Alignment:
| Q |
182 |
ttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
29034990 |
ttggcagggacaatgcattattatatgcaggggccggggttc |
29035031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 29664617 - 29664658
Alignment:
| Q |
182 |
ttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
29664617 |
ttggcagggacaatgcattgttatatgcaggggtcggggttc |
29664658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 11133083 - 11133131
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
11133083 |
agctcagttggtagggacaatgcattgttatatgcaggggtcggggttc |
11133131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 34120 - 34073
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120 |
agctcagttggcagggacatgcattgttatatgcaggggccggggttc |
34073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 17)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 34524883 - 34524930
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34524883 |
agctcagttggcagggacatgcattgttatatgcaggggccggggttc |
34524930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 10455755 - 10455797
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10455755 |
agttggcaggaacatgcattgttatatgcaggggccggggttc |
10455797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 30833030 - 30833072
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30833030 |
agttggcagggacatgcattgttatatgcaggggtcggggttc |
30833072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 4844156 - 4844197
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4844156 |
agttggcagggacatgcattgttatatgcaggggtcggggtt |
4844197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 8253672 - 8253630
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
8253672 |
agttggcatggacatgcattgttatatgcaggggctggggttc |
8253630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 19680330 - 19680288
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
19680330 |
agttggcatggacatgcattgttatatgcaggagccggggttc |
19680288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 20858465 - 20858423
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20858465 |
agttggcagggacatgcattgttatatgcaggggttggggttc |
20858423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Original strand, 9031774 - 9031811
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9031774 |
agctcagttggcagggacatgcattgttatatgcaggg |
9031811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 2945603 - 2945651
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
2945603 |
agctcagttggcagggacaatgcattgttatatgcaggggtcggggttc |
2945651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 8309172 - 8309212
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggcc |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8309172 |
agctcagttggcagggacatgcattgttatatgcatgggcc |
8309212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 9064873 - 9064921
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
9064873 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
9064921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 14981790 - 14981742
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
14981790 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
14981742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 3448366 - 3448407
Alignment:
| Q |
182 |
ttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
3448366 |
ttggcagggacaatgcattgttatacgcaggggccggggttc |
3448407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 212
Target Start/End: Original strand, 17176157 - 17176194
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
17176157 |
agctcagttgacagggacatgcattgttatatgcaggg |
17176194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 1488103 - 1488143
Alignment:
| Q |
182 |
ttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
1488103 |
ttggcagagacatgcattgttatatgcagaggtcggggttc |
1488143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 11520732 - 11520772
Alignment:
| Q |
182 |
ttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
11520732 |
ttggcagggatatgcattcttatatgcagtggccggggttc |
11520772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 212
Target Start/End: Complemental strand, 22730784 - 22730752
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
22730784 |
agttggcagagacatgcattgttatatgcaggg |
22730752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 32)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 20610747 - 20610794
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20610747 |
agctcagttggcagggacatgcattgttatatgcaggggccggggttc |
20610794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 20166324 - 20166371
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20166324 |
agctcagttggcagggacatgcattgttatatgcaggggccgaggttc |
20166371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 41492585 - 41492538
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41492585 |
agctcagttggcagggacatgcattattatatgcaggggccggggttc |
41492538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 36008282 - 36008330
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36008282 |
agctcagttggcagggacaatgcattgttatatgcaggggccggggttc |
36008330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 27921904 - 27921951
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27921904 |
agctcagttggtagggacatgcattattatatgcaggggccggggttc |
27921951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 49039532 - 49039485
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
49039532 |
agctcagttggcagggacatgcattgttatatgcagggactggggttc |
49039485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 56942 - 56900
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
56942 |
agttggcagggacatgcattgttatatgcaagggccggagttc |
56900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 4419768 - 4419726
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4419768 |
agttgtcagagacatgcattgttatatgcaggggccggggttc |
4419726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 14149800 - 14149848
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
14149800 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
14149848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 15185092 - 15185132
Alignment:
| Q |
181 |
gttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
15185092 |
gttggcagggatatgcattgttatatgcaggggtcggggtt |
15185132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 28520819 - 28520771
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
28520819 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
28520771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 212
Target Start/End: Original strand, 38657553 - 38657585
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38657553 |
agttggcagggacatgcattgttatatgcaggg |
38657585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 212
Target Start/End: Original strand, 42432021 - 42432053
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42432021 |
agttggcagggacatgcattgttatatgcaggg |
42432053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 56531324 - 56531276
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
56531324 |
agctcagttggcaaggacaatgcattgttatatgcaggggccggggttc |
56531276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 48968293 - 48968250
Alignment:
| Q |
180 |
agttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
48968293 |
agttggcagggacaatgcattattatatgcaggggccggggttc |
48968250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 49319401 - 49319448
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
49319401 |
agctcagttggcatggacatgcattattatatgcaggggtcggggttc |
49319448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 54854266 - 54854219
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
54854266 |
agctcagttggcagggacatgcataattatatgcaggggctggggttc |
54854219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 12585641 - 12585599
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
12585641 |
agttggcagggacatgcattgttatatgtaagggccggagttc |
12585599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 15853835 - 15853877
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| ||||||| |
|
|
| T |
15853835 |
agttggcaggaacatgcattgttatatacaggggctggggttc |
15853877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 17431390 - 17431432
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
17431390 |
agttgacagggacatgcattgttatatgcagaggcccgggttc |
17431432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 37997928 - 37997886
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| | ||||||| |
|
|
| T |
37997928 |
agttggcagggacattcattgttatatgcagggtctggggttc |
37997886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 218
Target Start/End: Original strand, 49743375 - 49743413
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggg |
218 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
49743375 |
agttggcagggatatgcattattatatgcaggggccggg |
49743413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 12796679 - 12796720
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
12796679 |
agttggcaggaacatacattgttatatgcaggggacggggtt |
12796720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 217
Target Start/End: Complemental strand, 14504715 - 14504678
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccgg |
217 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
14504715 |
agttggcaagaacatgcattgttatatgcaggggccgg |
14504678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 44449549 - 44449508
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
44449549 |
agttagcaggaacatgcattgttatatgtaggggccggggtt |
44449508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 9062187 - 9062231
Alignment:
| Q |
178 |
ttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||| ||||||| |
|
|
| T |
9062187 |
ttagttggcagggacatgcattattatatgcaagggttggggttc |
9062231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 9084766 - 9084810
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggg |
218 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
9084766 |
agctcagttggcagggacaatgcattgttatatgcaggggtcggg |
9084810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 9692969 - 9693017
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
9692969 |
agctcagttggcagggataatgcattattatatgcaggggccggggttc |
9693017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 31480278 - 31480318
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggc |
214 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31480278 |
agctcagttggcagggacaatgcattgttatatgcaggggc |
31480318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 48512206 - 48512246
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggc |
214 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48512206 |
agctcagttggcagggacaatgcattgttatatgcaggggc |
48512246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 211
Target Start/End: Complemental strand, 53180439 - 53180403
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcagg |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
53180439 |
agcttagttgacagggacatgcattgttatatacagg |
53180403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 53815703 - 53815751
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
53815703 |
agctcagttggcagggacaatgcattattatatgcaggggctggggttc |
53815751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 33)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 18003824 - 18003871
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18003824 |
agctcagttggcagggacatgcattgttatatgcaggggccggggttc |
18003871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 9768896 - 9768849
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9768896 |
agctcagttggcagggacatgcattgttatatgcaggggtcggggttc |
9768849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 42908779 - 42908826
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42908779 |
agctcagttggcagggacatgcattgttatatgcaggggtcggggttc |
42908826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 52961169 - 52961122
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52961169 |
agctcagttggcaaggacatgcattgttatatgcaggggccggggttc |
52961122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 50199558 - 50199516
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50199558 |
agttggtagggacatgcattgttatatgcaggggccggggttc |
50199516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 3341823 - 3341779
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccgggg |
219 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3341823 |
agctcagttggcagggacatgcattattatatgcaggggccgggg |
3341779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 7906408 - 7906366
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7906408 |
agttggtagggacatgcattgttatatgcaggggctggggttc |
7906366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 18179341 - 18179383
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
18179341 |
agttggcagggacatgcattgttatatgcagggaccggagttc |
18179383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 12553201 - 12553245
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccgggg |
219 |
Q |
| |
|
|||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
12553201 |
agctcagttggtaggaacatgcattgttatatgcaggggccgggg |
12553245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 17350068 - 17350116
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
17350068 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
17350116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 40678830 - 40678878
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
40678830 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
40678878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 1721148 - 1721191
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggg |
218 |
Q |
| |
|
|||| |||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
1721148 |
agctcagttggtaggaacatgcattgttatatgcaggggccggg |
1721191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 5862136 - 5862183
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| || || |||||||| |
|
|
| T |
5862136 |
agctcagttggcagggacatgcattgttatatgtagaggtcggggttc |
5862183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 9527433 - 9527480
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
9527433 |
agctcagttggcagggacaatgcattgttatatgcaggggtcggggtt |
9527480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 13870169 - 13870122
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
13870169 |
agctcagttggcagggacaatgcattattatatgcaggggccggggtt |
13870122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 47645883 - 47645836
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
47645883 |
agctcagttggcagagacatgcattgttatatgcagaggtcggggttc |
47645836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 50575909 - 50575956
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
50575909 |
agctcagttggaagggacatgcattgttatatgcaagggctggggttc |
50575956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 52833189 - 52833146
Alignment:
| Q |
180 |
agttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
52833189 |
agttggcagggacaatgcattattatatgcaggggccggggttc |
52833146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 2643902 - 2643856
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| ||| ||||||| |
|
|
| T |
2643902 |
agcttagttggcagagacatgcattattatatgcatgggtcggggtt |
2643856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 2903109 - 2903067
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
2903109 |
agttgccagggacatgcattgttatatgcagaggtcggggttc |
2903067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 3569057 - 3569099
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
3569057 |
agttggcagggacatgcattgttatatgtaggggtcagggttc |
3569099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 47141888 - 47141846
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
47141888 |
agttgacagggacatgcattgttatatgcaggggtcggagttc |
47141846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 1576206 - 1576165
Alignment:
| Q |
177 |
cttagttggcagggacatgcattgttatatgcaggggccggg |
218 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
1576206 |
cttagttggcagggatatgctttattatatgcaggggccggg |
1576165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 43020625 - 43020666
Alignment:
| Q |
181 |
gttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
43020625 |
gttggcagggacatgcattattatatgcaggggttggggttc |
43020666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 222
Target Start/End: Original strand, 1660966 - 1660998
Alignment:
| Q |
190 |
gacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1660966 |
gacatgcattattatatgcaggggccggggttc |
1660998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 2052770 - 2052722
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
2052770 |
agctcagttggcagggacaatgcattatcatatgcaggggccggggttc |
2052722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 212
Target Start/End: Original strand, 13941332 - 13941364
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
13941332 |
agttggcaaggacatgcattgttatatgcaggg |
13941364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 19976640 - 19976592
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
19976640 |
agctcagttggcagggacaatgtatggttatatgcaggggccggggttc |
19976592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 29491477 - 29491525
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
29491477 |
agctcagttggcagggacaatgcattattatatgcaggggtcggggttc |
29491525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 30632472 - 30632424
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
30632472 |
agctcagttgacagggacaatgcattgttatatgcaggggccgaggttc |
30632424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 212
Target Start/End: Complemental strand, 37262187 - 37262155
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
37262187 |
agttggcagggacatgcgttgttatatgcaggg |
37262155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 39238723 - 39238771
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||| ||||| |
|
|
| T |
39238723 |
agctcagttggcagggacaatgcattattatatgcaggggccgaggttc |
39238771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 47763473 - 47763425
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
47763473 |
agctcagttggcagggacaatgcattattatatgcaggggccggagttc |
47763425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 29)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 35195851 - 35195898
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35195851 |
agctcagttggcagggacatgcattattatatgcaggggccggggttc |
35195898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 38032937 - 38032895
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38032937 |
agttggcagggacatgcattgttatatacaggggccggggttc |
38032895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 21285441 - 21285393
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21285441 |
agctcagttggcagggacaatgcattgttatatgcaggggccggggttc |
21285393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 7465474 - 7465521
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7465474 |
agctcagttggcagagacatgcattattatatgcaggggccggggttc |
7465521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 32309235 - 32309188
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
32309235 |
agcttggttggcagggacatgcattgttatatgcaggggtcggagttc |
32309188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 17305477 - 17305436
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccg |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17305477 |
agctcagttggcagggacatgcattgttatatgcaagggccg |
17305436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 43209414 - 43209451
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccgg |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43209414 |
agttggcaggaacatgcattgttatatgcaggggccgg |
43209451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 7162748 - 7162708
Alignment:
| Q |
182 |
ttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
7162748 |
ttggcagggatatgcattgttatatgcaggggtcggggttc |
7162708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Original strand, 11808053 - 11808093
Alignment:
| Q |
182 |
ttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11808053 |
ttggtagggacatgcattgttatatgcaggggtcggggttc |
11808093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 20527517 - 20527469
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20527517 |
agctcagttggcagggacaatgcattgttatatgcaggggccggagttc |
20527469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 38451870 - 38451918
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38451870 |
agctcagttgacagggacaatgcattgttatatgcaggggccggggttc |
38451918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 47355828 - 47355864
Alignment:
| Q |
186 |
cagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47355828 |
cagggatatgcattgttatatgcaggggccggggttc |
47355864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 10020556 - 10020509
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10020556 |
agctcagttgacagggacatgcattgttatatgcaggggttggggttc |
10020509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 27726456 - 27726409
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
27726456 |
agctcagttggcagggacatgcattattataagcagtggccggggttc |
27726409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 37995632 - 37995586
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
37995632 |
agctcagttggcagagacatgcat-gttatatgcaggggccggggttc |
37995586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 14772417 - 14772375
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
14772417 |
agttggcagagacatgcattgttacatgtaggggccggggttc |
14772375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 15222869 - 15222827
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
15222869 |
agttggcagagacatgcattgttacatgtaggggccggggttc |
15222827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 218
Target Start/End: Original strand, 23799313 - 23799351
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggg |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
23799313 |
agttggcagagacatgcattgttatatgcaggggtcggg |
23799351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 43712395 - 43712353
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
43712395 |
agttggtagggacatgcattgttatatacaggggtcggggttc |
43712353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 1513500 - 1513533
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcagggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
1513500 |
agttggcagggacatgcattgttatatgtagggg |
1513533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 24427376 - 24427409
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcagggg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
24427376 |
agttggcagagacatgcattgttatatgcagggg |
24427409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Complemental strand, 29658341 - 29658312
Alignment:
| Q |
193 |
atgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29658341 |
atgcattgttatatgcaggggccggggttc |
29658312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 35498411 - 35498444
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcagggg |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
35498411 |
agttggcagggacatgcattattatatgcagggg |
35498444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 14818453 - 14818405
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
14818453 |
agctcagttggcagggacagtgcattattatatgcaggggtcggggttc |
14818405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 15265451 - 15265403
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
15265451 |
agctcagttggcagggacagtgcattattatatgcaggggtcggggttc |
15265403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 211
Target Start/End: Complemental strand, 19837398 - 19837362
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcagg |
211 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
19837398 |
agcttagttgacatggacatgcattgttatatgcagg |
19837362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 31475928 - 31475880
Alignment:
| Q |
175 |
agcttagttggcagggacat-gcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
31475928 |
agctcagttggcagggacattgcattattatatgcaggggctggggttc |
31475880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 41139094 - 41139142
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
41139094 |
agctcagttggcagggacaatgcattattatatgcaggggtcggggttc |
41139142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 42181559 - 42181523
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccg |
216 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
42181559 |
agttgacaaggacatgcattgttatatgcaggggccg |
42181523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 28)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 16874277 - 16874230
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16874277 |
agctcagttggcagggacatgcattgttatatgcaggggccgaggttc |
16874230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 21142820 - 21142773
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21142820 |
agcttagttggtagggacgtgcattgttatatgcaggggccggggttc |
21142773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 2903716 - 2903763
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| ||||||| |
|
|
| T |
2903716 |
agcttagttggcatggacatacattgttatatgcaggggctggggttc |
2903763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 19137627 - 19137674
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
19137627 |
agctcagttggcaggaacatgcattgttatatgcaggggccgaggttc |
19137674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 51412072 - 51412030
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
51412072 |
agttggcagggacatgcattgttatatgcaggagtcggggttc |
51412030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 3973310 - 3973351
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccg |
216 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3973310 |
agctcagttggtagggacatgcattgttatatgcaggggccg |
3973351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 3996566 - 3996525
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccg |
216 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3996566 |
agctcagttggtagggacatgcattgttatatgcaggggccg |
3996525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 4010105 - 4010064
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccg |
216 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4010105 |
agctcagttggtagggacatgcattgttatatgcaggggccg |
4010064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 24130572 - 24130613
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
24130572 |
agttggcagggacatacattgttatatgcaggggacggggtt |
24130613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 27119274 - 27119331
Alignment:
| Q |
166 |
gtccccgtgagcttagtt-ggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
27119274 |
gtccccgtgagcatagctcggcagggacatgcattgttatatgcagaggtcggggttc |
27119331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 9624990 - 9625038
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
9624990 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
9625038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 14868692 - 14868740
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
14868692 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
14868740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 27183769 - 27183721
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
27183769 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
27183721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 43774192 - 43774240
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
43774192 |
agctcagttggcagggacaatgcattgttatatgcaggggtcggggttc |
43774240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 211
Target Start/End: Original strand, 51017798 - 51017834
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcagg |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51017798 |
agctcagttggcagggacatgcattgttatatgcagg |
51017834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 40160750 - 40160789
Alignment:
| Q |
182 |
ttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
40160750 |
ttggcagggacatgcattgttatatgccggggctggggtt |
40160789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Complemental strand, 3993782 - 3993748
Alignment:
| Q |
187 |
agggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
3993782 |
agggacatgcattgttatatgcaggggccgcggtt |
3993748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 4045716 - 4045674
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || ||||| |
|
|
| T |
4045716 |
agttgacagggacatgcattgttatatgcaggggtcgaggttc |
4045674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 209
Target Start/End: Complemental strand, 12143494 - 12143460
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgca |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
12143494 |
agctcagttggcagggacatgcattgttatatgca |
12143460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 213
Target Start/End: Original strand, 12236607 - 12236645
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcagggg |
213 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
12236607 |
agctcagttggcagggacatgcattattatatgcagggg |
12236645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 24160610 - 24160568
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
24160610 |
agttggcagagacatgcactgttatatgcaggggtcggggttc |
24160568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 31108842 - 31108800
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31108842 |
agttggcagggacatgcataattatatgcaggggctggggttc |
31108800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 34407172 - 34407130
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
34407172 |
agttggcagggacatgcattattatatgcaggggttggggttc |
34407130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 16999942 - 16999983
Alignment:
| Q |
181 |
gttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
16999942 |
gttggcagggacatgcattattatatgtaggggccggagttc |
16999983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 208
Target Start/End: Complemental strand, 30745818 - 30745785
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgc |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
30745818 |
agctcagttggcagggacatgcattgttatatgc |
30745785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Complemental strand, 42271082 - 42271053
Alignment:
| Q |
193 |
atgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42271082 |
atgcattgttatatgcaggggccggggttc |
42271053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 26583120 - 26583156
Alignment:
| Q |
186 |
cagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
26583120 |
cagggacatgcattattatatgcaggggtcggggttc |
26583156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 43911622 - 43911666
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccgggg |
219 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
43911622 |
agcttagttggcagagacatatattgttatatgcaggggtcgggg |
43911666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 14011120 - 14011078
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14011120 |
agttggcagggacatgcattgttatatgcaggggccggagttc |
14011078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 1588774 - 1588822
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
1588774 |
agcttagttggcagggacaatgcattattatatgcaggggccggggttc |
1588822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 14012624 - 14012667
Alignment:
| Q |
180 |
agttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14012624 |
agttggcagggacaatgcattgttatatgcaggggccggggttc |
14012667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 22847345 - 22847302
Alignment:
| Q |
179 |
tagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
22847345 |
tagttggcagggacatgcattgttatatgcaggggtcgaggttc |
22847302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 26657864 - 26657911
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26657864 |
agctcagttggtagggacatgcattgttatatgcagggaccggggttc |
26657911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 2800026 - 2800074
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2800026 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
2800074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 2696545 - 2696588
Alignment:
| Q |
180 |
agttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2696545 |
agttggcagggacaatgcattattatatgcaggggccggggttc |
2696588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 29937218 - 29937265
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
29937218 |
agctcagttggtagggacatgtattgttatatgcaggggccggagttc |
29937265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 39432415 - 39432368
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
39432415 |
agctcagttggcagggacatgcaatgttatatgcaggggttggggttc |
39432368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 218
Target Start/End: Original strand, 7345441 - 7345479
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggg |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
7345441 |
agttggcagggacatgcattattatatgcaggggtcggg |
7345479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 18577126 - 18577168
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
18577126 |
agttgacagggacatgtattgttatatgcaggggtcggggttc |
18577168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 222
Target Start/End: Complemental strand, 41793046 - 41793013
Alignment:
| Q |
189 |
ggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
41793046 |
ggacatgcattgttatatgcaggagccggggttc |
41793013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 4955063 - 4955023
Alignment:
| Q |
182 |
ttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| ||||| |
|
|
| T |
4955063 |
ttggcagagacatgtattgttatatgcaggggccgtggttc |
4955023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 35301251 - 35301203
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
35301251 |
agctcagttggcagggacaatgcattattatatgcaggggtcggggttc |
35301203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 219
Target Start/End: Complemental strand, 38790656 - 38790616
Alignment:
| Q |
180 |
agttggcagggaca-tgcattgttatatgcaggggccgggg |
219 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
38790656 |
agttggcagggacaatgcattattatatgcaggggccgggg |
38790616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 18)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 11246581 - 11246537
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccgggg |
219 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11246581 |
agctcagttggcagggacatgcattgttatatgcaggggtcgggg |
11246537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 218
Target Start/End: Original strand, 25660920 - 25660963
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggg |
218 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25660920 |
agctcagttggcagggatatgcattgttatatgcaggggccggg |
25660963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 38040274 - 38040321
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
38040274 |
agctcagttggcagggacatgcattgttatatgcaggggtcgaggttc |
38040321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 42781681 - 42781634
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42781681 |
agctcagttggcagggacatgcattgttatatgcagggttcggggttc |
42781634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 3536018 - 3535976
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
3536018 |
agttggcagggacatgcattgttatatacaggagccggggttc |
3535976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 20186879 - 20186920
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
20186879 |
agttggcagggacatgcattattatatgcaggggtcggggtt |
20186920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 1463878 - 1463926
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
1463878 |
agctcagttggcagggacaatgcattattatatgcaggggccggggttc |
1463926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 6447563 - 6447520
Alignment:
| Q |
180 |
agttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
6447563 |
agttggcagggacaatgcattattatatgcaggggccggggttc |
6447520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 35813329 - 35813290
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggc |
214 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35813329 |
agctcagttgacagggacatgcattgttatatgcaggggc |
35813290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Original strand, 17557043 - 17557085
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
17557043 |
agttggcagagacatgcattgttatatgtaggggtcggggttc |
17557085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 38040174 - 38040132
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
38040174 |
agttggcaaggacatgcattgttatatgcagggttcggggttc |
38040132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 222
Target Start/End: Original strand, 28537157 - 28537190
Alignment:
| Q |
189 |
ggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
28537157 |
ggacatgcattgttatatgcatgggccggggttc |
28537190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 31556836 - 31556873
Alignment:
| Q |
185 |
gcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31556836 |
gcagggacatgcattgttatatgcaggggtcggagttc |
31556873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 31907664 - 31907697
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcagggg |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
31907664 |
agtttgcagggacatgcattgttatatgcagggg |
31907697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 41405170 - 41405129
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
41405170 |
agttgacagggacatgcattgttatatgcaagggtcggggtt |
41405129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 9963423 - 9963471
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
9963423 |
agctcagttggcagggacaatgcattgttatatgcaggggttggggttc |
9963471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 20735263 - 20735215
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
20735263 |
agctcagttggcagggacaatgcattattatatgtaggggccggggttc |
20735215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Original strand, 31292548 - 31292584
Alignment:
| Q |
186 |
cagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |
|
|
| T |
31292548 |
cagggacatgcattgttatatgcaggagctggggttc |
31292584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 213
Target Start/End: Original strand, 4528 - 4566
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcagggg |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4528 |
agctcagttggcagggacatgcattgttatatgcagggg |
4566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 213
Target Start/End: Original strand, 4548 - 4586
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcagggg |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4548 |
agctcagttggcagggacatgcattgttatatgcagggg |
4586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 25043 - 25001
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
25043 |
agttggcagagacatgcaatgttatatgcaggggccggggttc |
25001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 440407 - 440454
Alignment:
| Q |
175 |
agcttagttggcagggacatgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
440407 |
agctcagttggcaggaacatgcattattatatgtaggggccggggttc |
440454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1343 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1343
Description:
Target: scaffold1343; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 217
Target Start/End: Complemental strand, 959 - 922
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccgg |
217 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
959 |
agttggcaagaacatgcattgttatatgcaggggccgg |
922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0247 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0247
Description:
Target: scaffold0247; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 20736 - 20777
Alignment:
| Q |
180 |
agttggcagggacatgcattgttatatgcaggggccggggtt |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
20736 |
agttggcagggacatacattgttatatgcatggaccggggtt |
20777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 25033 - 25081
Alignment:
| Q |
175 |
agcttagttggcagggaca-tgcattgttatatgcaggggccggggttc |
222 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
25033 |
agctcagttggcagggacaatgcattattatatgcaggggctggggttc |
25081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University