View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_high_49 (Length: 240)
Name: NF20634_high_49
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_high_49 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 41992362 - 41992582
Alignment:
| Q |
20 |
agagtgtgacaatagcacattgtaagaaagagatgcattgttgaattggtttggtttgnnnnnnngtatgaatccccgtttatttgggtatggtatggat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41992362 |
agagtgtgacaatagcacattgtaagaaagagatgcattgttgaattggtttggtttgtttttttgtatgaatccccgtttatttgggtatggtatggat |
41992461 |
T |
 |
| Q |
120 |
tccaaatggtaaggtggggtccatttgatgtttgtctggtggttttggaggcattgcacgcccttttataccccatcggtgcctctttactaagaccaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41992462 |
tccaaatggtaaggtggggtccatttgatgtttgtctggtggttttggaggcattgcacgccctttcataccccatcggtgcctctttactaagaccaac |
41992561 |
T |
 |
| Q |
220 |
gtgggttgggaccattacttc |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41992562 |
gtgggttgggaccattacttc |
41992582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University