View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_high_54 (Length: 227)
Name: NF20634_high_54
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_high_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 55076619 - 55076830
Alignment:
| Q |
1 |
aggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076619 |
aggaccctgtcgtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaat |
55076718 |
T |
|
| Q |
101 |
atccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076719 |
atccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacat |
55076818 |
T |
|
| Q |
201 |
gtttcttcttat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
55076819 |
gtttcttcttat |
55076830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 15125434 - 15125312
Alignment:
| Q |
1 |
aggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaat |
100 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||| ||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||| || ||| |
|
|
| T |
15125434 |
aggaccttgtcgtgccttcattggtgacctcgctggtggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatggccgtcggtaat |
15125335 |
T |
|
| Q |
101 |
atccttggttatgccgccggctc |
123 |
Q |
| |
|
||||||||||||| || ||||| |
|
|
| T |
15125334 |
gtccttggttatgctgctggctc |
15125312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 168
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
| Q |
86 |
atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc |
168 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||||| ||| ||||||||||| |||| ||||||| |||||| |||| ||||| |
|
|
| T |
43665688 |
atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc |
43665606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University