View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20634_high_56 (Length: 216)

Name: NF20634_high_56
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20634_high_56
NF20634_high_56
[»] chr1 (1 HSPs)
chr1 (24-201)||(9699768-9699945)


Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 9699945 - 9699768
Alignment:
24 tagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggagacaaacttggacgcaagaaagtttatggtgtcacact 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9699945 tagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggagacaaacttggacgcaagaaagtttatggtgtcacact 9699846  T
124 cattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccccgaaatctgttatgttaaccctttg 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||    
9699845 cattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccgcgaaatctgttatgataaccctttg 9699768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University