View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_14 (Length: 421)
Name: NF20634_low_14
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 61 - 404
Target Start/End: Original strand, 22790995 - 22791338
Alignment:
| Q |
61 |
gttttgatgtcggattttatgtnnnnnnnncaaattatttttcttgtaccttatattggcgtattacattgattatgaaacgctttctatcaaatatttt |
160 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22790995 |
gttttgatgtcggattttatgtaaaaaaa-caaattatttttcttgtaccttatattggcgtattacattgattatgaaacgctttctatcaaatatttt |
22791093 |
T |
 |
| Q |
161 |
ccaccctactatcttacaataagaaacaatcaatcttggttagacagtgtggttccatgagttacaatcacatagcttttatgaaattattatattttgc |
260 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22791094 |
ctaccctactatcttacaataagaaacaatcaatcttggttagacagtgtggttccatgagttacaatcacatagcttttatgaaattattatattttgc |
22791193 |
T |
 |
| Q |
261 |
ataaagtgtcttctcctctagggatttatatggcactcgtggacactttgtgttctgacaacacacaaacaacccagacattgtcttagtctcagagctt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22791194 |
ataaagtgtcttctcctctagggatttatatggcacttgtggacactttgtgttctgacaacacacaaacaacccagacattgtcttagtctcagagctt |
22791293 |
T |
 |
| Q |
361 |
tcatagcatttatttgtgtccggccccct-aaaagaccttcattc |
404 |
Q |
| |
|
|| | |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22791294 |
tcttggcatttatttgtgtccggccccctaaaaagaccttcattc |
22791338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University