View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_23 (Length: 387)
Name: NF20634_low_23
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 129 - 377
Target Start/End: Complemental strand, 9670126 - 9669878
Alignment:
| Q |
129 |
gtgaaatgattgttggggtggttcgattgcattcaagnnnnnnnn-cttcttctttgcatgtatagtcttctggttggtgaggatattcaggatgcttgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9670126 |
gtgaaatgattgttggggtggttcgattgcattcaagtttttttttcttcttctttgcatgtatagtcttctggttggtgaggatattcaggatgcttgt |
9670027 |
T |
|
| Q |
228 |
ttggttcaataatttaatttttctcaccaacttatattcacaacacaacgttctttctgattatttttcatattatcacttgttatggttactattccac |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9670026 |
ttggttcaataatttaatttttctcaccaacttatattcacaacacaacgttctttctgattatttttcatattatcactttttatggttactattccac |
9669927 |
T |
|
| Q |
328 |
nnnnnnnngcatgtttctgtcagtaacgtatttaatgattttaccctatg |
377 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9669926 |
-tttttttgcatgtttccgtcagtaacgtatttaatgattttaccctatg |
9669878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 9670242 - 9670203
Alignment:
| Q |
13 |
tcatcacgcatttcatttcatcttcaattttcattctcaa |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9670242 |
tcatcgcgcatttcatttcatcttcaattttcattctcaa |
9670203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 179 - 377
Target Start/End: Original strand, 34329142 - 34329346
Alignment:
| Q |
179 |
tctttgcatgtatagtcttctggttggtgaggatattcaggatgcttgtttggttcaataatttaatttt----------tctcaccaacttatattcac |
268 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
34329142 |
tctttgcatgtatagtcttatggttggtgaggatattcaggatgcttgtttggttcaataatttaattttcttactacaatctcaccaacttatattatc |
34329241 |
T |
|
| Q |
269 |
aacacaacgttctttctgattatttttcata---ttatcacttgttatggttactattccacnnnnnnnngcatgtttctgtcagtaacgtatttaatga |
365 |
Q |
| |
|
||| ||| ||| |||||||||||| || |||| |||||||||| ||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34329242 |
aac-----gtt-tttgtgattatttttcttagtattataacttgttatgtttattattccacttttttt-gcatgtttctgtcagtaacgtatttaatga |
34329334 |
T |
|
| Q |
366 |
ttttaccctatg |
377 |
Q |
| |
|
| ||| |||||| |
|
|
| T |
34329335 |
tcttagcctatg |
34329346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 129 - 248
Target Start/End: Original strand, 34329084 - 34329211
Alignment:
| Q |
129 |
gtgaaatgattgttggggtggttcgattgcattcaagnnnnnnnncttct--------tctttgcatgtatagtcttctggttggtgaggatattcagga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34329084 |
gtgaaatgattgttggggtggttcgattgcattcaagttttttttttttttttttttgtctttgcatgtatagtcttatggttggtgaggatattcagga |
34329183 |
T |
|
| Q |
221 |
tgcttgtttggttcaataatttaatttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34329184 |
tgcttgtttggttcaataatttaatttt |
34329211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University