View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_35 (Length: 290)
Name: NF20634_low_35
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 8438173 - 8438454
Alignment:
| Q |
1 |
tacagagttcttttgttttctctgattcatctcccataacaagaagaaactcaacatcgttacatgttcggcttaggtcaaccaagaaagggtatatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438173 |
tacagagttcttttgttttctctgattcatctcccataacaagaagaaactcaacatcgttacatgttcggcttaggtcaaccaagaaagggtatatctc |
8438272 |
T |
 |
| Q |
101 |
tatgctttctgagtcgtcgcttgtagcgtactcaacaacaacgagtttgtcttttgctgattcaagtgcttcgtcgaactcttctatgctgtgaactctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8438273 |
tatgctttctgagtcgtcgcttgtagcgtactcaacaacaacgagtttatcttttgctgattcaagtgcttcgtcgaactcttctatgctatgaactctt |
8438372 |
T |
 |
| Q |
201 |
tgaactcttgcatcttttttcttcttagcatctgaagctgctgtgcctgttgcttttgtgataacaacacgtcgtctctgct |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8438373 |
tgaactcttgcatcttttttcttcttagcatctgaagctgctgtgcctgttgctttggtgataacaacacgtcgtctctgct |
8438454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University