View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_45 (Length: 259)
Name: NF20634_low_45
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 8437960 - 8438196
Alignment:
| Q |
13 |
catcaagaacaataagcttatgatcaatcttatgatcctcaataagtttctcaacatcttctctgttgtgaagttgcactacacctgaatggttatcacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437960 |
catcaagaacaataagcttatgatcaatcttatgatcctcaataagtttctcaacatcttctctgttgtgaagttgcactacacctgaatggttatcacc |
8438059 |
T |
 |
| Q |
113 |
gtagtataacacatcaccaacaagcatatctggaccaatagcttcttcttcatgaattttttctttgctcttgtagaaagtgaagtgtggtactttatca |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438060 |
gtagtataaaacatcaccaacaagcatatctggaccaatagcttcttcttcatgaattttttctttgctcttgtagaaagtgaagtgtggtactttatca |
8438159 |
T |
 |
| Q |
213 |
accttttctcttttacagagttcttttgttttctctg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438160 |
accttttctcttttacagagttcttttgttttctctg |
8438196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University