View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20634_low_47 (Length: 251)
Name: NF20634_low_47
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20634_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 48074342 - 48074581
Alignment:
| Q |
1 |
tatatgcatatgtaactgctagctatacttcatagtagcttattatagctaatactcttgtaatgagtacagcaacaggtctcatannnnnnn------- |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48074342 |
tatatgcatatgtaactgctagctatacttcatagtagcttattatagctaatactcttgtaatgagtacagcaacaggtctcatatatttttttttttt |
48074441 |
T |
 |
| Q |
94 |
atacacttgattaattaaaatcaaaaccactcactagtgtccccaaccttaatattctgactccagttaagcacccttgcaagccattcatcgtcaaaat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48074442 |
atacacttgattaattaaaatcaaaaccactcactagtgtccccaaccttaatattctgactccagttaagcacccttgcaagccattcatcgtcaaaat |
48074541 |
T |
 |
| Q |
194 |
caccttcttcgtcttcttccatatatttgtattcttcaac |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48074542 |
caccttcttcgtcttcttccatatatttgtattcttcaac |
48074581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University