View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20634_low_50 (Length: 240)

Name: NF20634_low_50
Description: NF20634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20634_low_50
NF20634_low_50
[»] chr4 (1 HSPs)
chr4 (10-221)||(4534717-4534928)
[»] chr7 (1 HSPs)
chr7 (21-196)||(24628700-24628875)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 4534928 - 4534717
Alignment:
10 agcagcacagaatccatttttgggaagaagagagaaagcattggaatggtttaacaactcatcaccaaaagcccagtaaacggcaacagctgaaggaatc 109  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
4534928 agcatcacggaatccatttttgggaagaagagagaaagcattggaatggtttaacaattcatcaccaaaagcccagtaaacggcaacagctgaaggaatc 4534829  T
110 gttaatgtgaaaacgtacaaagttgccagaaaatatatgtacttgaacttttgaggtttccacattgcatgcataatctctctgcaatgtaaacgtgtgt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
4534828 gttaatgtgaaaacgtacaaagttgccagaaaatatatgtacttgaacttttgaggtttccacattgcatgcataatctctctgcaatgcaaacgtgtgt 4534729  T
210 gtatgtcacaat 221  Q
    ||||||||||||    
4534728 gtatgtcacaat 4534717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 21 - 196
Target Start/End: Complemental strand, 24628875 - 24628700
Alignment:
21 atccatttttgggaagaagagagaaagcattggaatggtttaacaactcatcaccaaaagcccagtaaacggcaacagctgaaggaatcgttaatgtgaa 120  Q
    |||||||||| || || ||||||||||||||||||||||| |  |  ||||| ||||| ||||| ||||| |||   || ||||||||||||||||||||    
24628875 atccatttttaggtaggagagagaaagcattggaatggttaagaagttcatctccaaaggcccaataaacagcagtggcagaaggaatcgttaatgtgaa 24628776  T
121 aacgtacaaagttgccagaaaatatatgtacttgaacttttgaggtttccacattgcatgcataatctctctgcaa 196  Q
    |||||| ||||||||||  ||||||||||||||||| ||||| || |||||||| || ||||||||||||||||||    
24628775 aacgtataaagttgccatcaaatatatgtacttgaatttttgtggcttccacatggcgtgcataatctctctgcaa 24628700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University